Тиамин и бенфотиамин предотвращают апоптоз перицитов сетчатки человека, вызванный повышенным накоплением глюкозы в экстрацеллюлярном матриксе

Читайте в новом номере

Импакт фактор - 0,584*

*пятилетний ИФ по данным РИНЦ

Регулярные выпуски «РМЖ» №15 от 09.07.2010 стр. 968
Рубрика: Эндокринология

Для цитирования: Beltramo E., Нижерадзе K., Berrone E., Tarallo S., Porta M. Тиамин и бенфотиамин предотвращают апоптоз перицитов сетчатки человека, вызванный повышенным накоплением глюкозы в экстрацеллюлярном матриксе // РМЖ. 2010. №15. С. 968

Утолщение базальной мембраны капилляров – один из первых этапов развития диабетической микроангиопатии [1–3], который также описан у крыс при избыточном потреблении глюкозы, и развития диабетоподобной ретинопатии на фоне гипергликемии [4,5]. Дебют и течение диабетической ретинопатии зависят от качественного и количественного изменения экстрацеллюлярного матрикса (ЭЦМ) базальной мембраны капилляров. В частности, изменение состояния некоторых компонентов ЭЦМ влияет на характеристики эндотелия [6] и связанные с ЭЦМ факторы роста [7], хотя механизмы до сих пор остаются неясными.

Утолщение базальной мембраны капилляров – один из первых этапов развития диабетической микроангиопатии [1–3], который также описан у крыс при избыточном потреблении глюкозы, и развития диабетоподобной ретинопатии на фоне гипергликемии [4,5]. Дебют и течение диабетической ретинопатии зависят от качественного и количественного изменения экстрацеллюлярного матрикса (ЭЦМ) базальной мембраны капилляров. В частности, изменение состояния некоторых компонентов ЭЦМ влияет на характеристики эндотелия [6] и связанные с ЭЦМ факторы роста [7], хотя механизмы до сих пор остаются неясными.
Эндотелий играет огромную роль в синтезе ЭЦМ капилляров. Гибель эндотелиальных клеток – поздняя стадия развития диабетической ретинопатии, как правило, связанная с отсутствием перфузии капилляров [8], в то время как избирательная гибель встроенных в ЭЦМ перицитов наряду с утолщением базальной мембраны – намного более ранний этап [9]. Гибель перицитов имеет большое влияние на ремоделирование капилляров и может вызвать первые аномалии, выявляемые клинически, поскольку перициты тесно связаны с эндотелиальными клетками и могут регулировать их пролиферацию, получая от них питательные вещества и факторы роста [10]. Утолщение базальной мембраны может прервать эту связь и вызвать апоптоз перицитов и их выпадение, в то время как эндотелий может начать бесконтрольно пролиферировать [11]. Отсутствие перицитов делает капилляры более уязвимыми к формированию микроаневризм, что, в свою очередь, связано с фокальным увеличением числа паренхиматозных клеток эндотелия [12]. Кроме того, на гораздо более поздних стадиях пролиферативной диабетической ретинопатии связь между отсутствием перицитов и неоваскуляризацией сетчатки позволяет предположить, что перициты подавляют рост капилляров [11,13,14].
Тиамин и бенфотиамин, липофильный аналог тиамина монофосфата, хорошо известны как препараты, защищающие от метаболических повреждений, вызванных высоким уровнем глюкозы (ВУГ) в сосудистых клетках [15]. В предыдущих работах сообщалось об уменьшении адгезии на фоне лечения тиамином и аминогуанидином [16,17], однако изменений в апоптозе выявлено не было. Исследование проводилось на перицитах сетчатки крупного рогатого скота, культивированных на ЭЦМ, продуцируемом эндотелиальными клетками человека при высоких концентрациях глюкозы (ВУГ–ЭЦМ).
Однако было доказано, что перициты быка ведут себя иначе, чем человеческие, при культивировании в экспериментальных условиях, которые имитируют микроокружение при диабете [18,19].
Целью данного исследования стала оценка поведения перицитов сетчатки человека (ПСЧ), как свободных, так и зафиксированных, при культивировании на ВУГ–ЭЦМ, синтезированном эндотелиальными клетками при гипергликемии, и возможное влияние тиамина и бенфотиамина на изменение их поведения.
Материалы и методы
Культуры клеток
Эндотелиальные клетки пупочной вены человека (Human umbilical vein endothelial cells – HUVEC) были получены из пуповины человека, как описано ранее [20]. Клеточные пулы из 3–5 пуповин были выращены в Medium 199 – Hepes Modification, с добавлением 20% фетальной телячьей сыворотки (FCS), до слияния. Во вторичной культуре HUVEC помещали в M199 +20% FCS с добавлением 50 мкг/мл сыворотки для роста эндотелиальных клеток. HUVEC описывали с помощью фактора Виллебранда при непрямой иммунофлюоресценции.
ПСЧ были приобретены у Cambrex Corporation, East Rutherford, NJ, USA. Они использовались в качестве свободных (wild–type – WT–ПСЧ) или зафиксированных (immortalized – Bmi–ПСЧ), как описано ранее [21]. Оба типа перицитов характеризовались иммунофлуоресцентным окрашиванием специфическими маркерами: αα–актин гладких мышц, десмин, рецептор тромбоцитарного фактора роста – бета и протеогликан NG–2. Они были вырощены в DMEM 5,6 ммоль/л глюкозы с 20% FCS в первичных культурах и 10% FCS во вторичных культурах. Эксперименты с живыми клетками выполнялись на 3–5–й субкультуре. Все реагенты для клеточных культур были закуплены Sigma–Aldrich, Сент–Луис, Миссури, США.
Продукция матрикса
HUVEC в первичной культуре были выделены трипсином – ЭДТА и помещены в 6–луночные планшеты. После адгезии среду удаляли и заменяли средой, содержащей физиологический (5,6 ммоль/л, нормальный уровень глюкозы – НУГ) или высокий (28 ммоль/л, ВГ) уровень D–глюкозы. После 7 дней культивирования их промывали в буферном фосфатном растворе (БФР) и затем в течение 4 мин – в 0,2 моль/л растворе NH4OH, чтобы отделить клетки. Затем клетки промывали 4 раза в БФР с PBS. WT–ПСЧ и Bmi–HRP были помещены в те же чащи, на ЭЦМ, синтезированный HUVEC, и культивировались либо 18 ч, либо 7 дней в условиях НУГ или ВУГ, в зависимости от эксперимента.
В дальнейшей серии экспериментов матрикс продуцировался HUVEC при НУГ, ВУГ (ВУГ–ЭЦМ) и ВУГ+50 или 100 мкмоль/л тиамина (T) или бенфотиамина (БТ). Эквимолярные концентрации маннитола были добавлены в обе культуры – HUVEC и ПСЧ в качестве осмотического контроля.
Клеточная адгезия
Перициты выращивались на ЭЦМ, продуцируемом HUVEC, или непосредственно на пластике (контроль), и культивировались 18 ч при НУГ. ПСЧ затем считали в камерах Бюркера после окраски трипановым голубым для исключения мертвых клеток.
Пролиферации клеток – подсчет
Перициты выращивались на ЭЦМ, продуцируемом HUVEC, или непосредственно на пластике (контроль), и культивировались 7 дней при НУГ или ВУГ. Затем производился подсчет по описанной выше методике.
Пролиферации клеток – синтез ДНК
Включение пиримидиновых аналогов 5–бром– 2–дезоксиуридина (BrdU) вместо тимидина в ДНК пролиферирующих клеток выявлено с помощью иммуноанализа (Cell Proliferation ELISA, BrdU, Roche Diagnostics, Mannheim, Германия), в соответствии с инструкциями изготовителя, через 7 дней культивирования перицитов в НУГ или ВУГ на ЭЦМ. Поглощение читалось на 450 нм в ELISA reader (Victor 3, PerkinElmer, Уэлсли, штат Массачусетс, США).
Апоптоз – фрагментация ДНК
Апоптоз оценивали с использованием Cell Death Detection ELISAPLUS (Roche), в соответствии с инструкцией завода–изготовителя, через 7 дней культивирования перицитов в НУГ или ВУГ на выращенном ЭЦМ. Поглощение считывалось на 405 нм в Victor 3 ELISA reader и значение нормализовалась по отношению к общему числу ДНК, измеренном на 260 нм.
Апоптоз – экспрессия мРНК Bax, Bcl–2 и p53
Экспрессия мРНК Bax, р53 и Bcl–2 анализировалась с помощью относительной количественной мультиплексной обратной транскриптазо–полимеразной цепной реакции (RT–PCR). Всего РНК была выделен из перицитов, после 7 дней культивирования на созданном ЭЦМ, с помощью High Pure RNA Isolation kit (Roche). Зараженная ДНК удалялась с помощью ДНазы I, прилагаемой в комплекте. Образец каждой пробы РНК был проверен спектрофотометрическим измерением поглощения при 260 нм.
RT–PCR проводилась с использованием 0,5 мкг РНК с помощью комплекта Qiagen OneStep RT–PCR (Qiagen GmbH, Hilden, Германия). Анализ был разработан для мультиплексной RT–PCR, каждый набор реактивов содержал праймеры для интересующего гена и βα–актина в качестве внутреннего контроля, с использованием QuantumRNA βα–actin Internal Standards (Ambion, Austin, Texas, USA). Амплификация проводилась при следующих параметрах: Bax: при 50°C в течение 30 мин (RT шаг), проводилось при температуре 95°C в течение 15 мин (горячий старт для ПЦР), 28 циклов 95°C (30с)/55°C (30с)/72°C
(1 мин), после чего окончательное выдерживание при 72°С в течение 10 мин; р53: 50°C в течение 30 мин
(RT шаг), 95°C в течение 15 мин (Горячий старт для PCR), 30 циклов 95°C (30) / 55°C (30 с) / 72°C (1 мин), заключительная выдержка при 72°С в течение 10 мин; Bcl–2: при 50°C в течение 30 мин (RT шаг), 95°C на 15 мин (горячий старт для PCR), 35 циклов 95°C (30 с)/58°C (30 с) / 72°C
(1 мин), заключительно – при 72°С в течение 10 мин.
Число циклов для каждой из реакций определяется линейным диапазоном амплификации. Продукты RT–PCR визуализировались с помощью электрофореза в 2%–ном агарозном геле, содержащем 1 мкг/мл бромистого этидия, и оценены количественно с использованием аналитической системы (Kodak Gel Logic Image Analysis System, Kodak, Rochester, NY, USA). Для определения уровня экспрессии мРНК, оценивалось отношение Bax (или Bcl–2 и р53)/ βα–актину (по Инструкции QuantumRNA–актин).
Праймеры для Bax распределились следующим образом: 5’ праймер, CCAGCTCTGAGCAGATCATG; 3’ праймер, CTGGAAGAAGATGGGCTGAGG, которые ге­нерируют продукт 541–bp.
р53: 5’, CCTCACCATCATCACACTGG; 3’, GACAGAAGGGCCTGACTCAGAC (427–BP). Bcl–2: 5’, GCCAGGACCTCGCCGCTGCAG 3’, GCTTGCATCACCCTGGGTGCC (504–BP).
Апоптоз – концентрация белков Bax, Bcl–2 и p53
Концентрации белков Bax, Bcl–2 и p53 определялись методом ИФА с использованием коммерческих наборов (Bax EIA Kit, Assay Designs Inc, Ann Arbor, MI, USA; Human Bcl–2 ELISA Kit, Bender MedSystems GmbH, Vienna, Austria; Human p53 ELISA Kit, Bender MedSystems). Поглощение считывалось на 450 нм на приборе Victor 3 ELISA и нормализовалась по общем содержания белка измеренном на 595 нм после реакции Брэдфорда.

Статистический анализ
Результаты представлены как среднее значение ±SD шести опытов. Результаты экспрессии мРНК приведены в процентах от результатов, полученных при положительных условиях в контроле (т.е. выращенные ПСЧ при НУГ на НУГ–ЭЦМ) в каждом эксперименте. Статистическое сравнение между группами проводилось с помощью t–теста Стьюдента для парных данных или теста Вилкоксона. Результаты считались достоверными при значении р

Оцените статью


Поделитесь статьей в социальных сетях

Порекомендуйте статью вашим коллегам

Предыдущая статья
Следующая статья

Авторизируйтесь или зарегистрируйтесь на сайте для того чтобы оставить комментарий.

зарегистрироваться авторизоваться
Наши партнеры
Boehringer
Jonson&Jonson
Verteks
Valeant
Teva
Takeda
Soteks
Shtada
Servier
Sanofi
Sandoz
Pharmstandart
Pfizer
 OTC Pharm
Lilly
KRKA
Ipsen
Gerofarm
Gedeon Rihter
Farmak